cDNA

MGC:77059

ID
ZDB-CDNA-040425-3209
Name
MGC:77059
Symbol
MGC:77059
Previous Names
  • FR_9001 (1)
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NCI_CGAP_ZKid1
Digest
Insert Size
1983
Cloning Site
NotI-SmaI
Vector Type
phagemid
Vector
pCMV-SPORT6.1
Polymerase
T7 RNA polymerase
PCR Amplification
Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Quality
( Moderate expression pattern )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
7 figures (10 images) from Thisse et al., 2004 [MGC:77059]
Marker Relationships
Sequences
Citations