ZFIN ID: ZDB-CDNA-040425-3144
cDNA Name: MGC:85923
Sequence Ontology ID : SO:0000756
Previous Name: FR_6955 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: NCI_CGAP_ZKid1
Digest:
Insert Size: 1416
Cloning Site: NotI-SmaI
Vector Type: phagemid
Vector: pCMV-SPORT6.1
Polymerase: T7 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' AACAGCTATGACCATGATTAC 3'
5' GTAAAACGACGGCCAGT 3'
Source:
Zebrafish Gene Collection (ZGC) (order this)
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 1 figure (1 image) from Thisse et al., 2004 [MGC:85923]
MARKER RELATIONSHIPS
MGC:85923 Is Encoded by: [Gene] mpzl3 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC067698 (1) 1416bp
Polypeptide GenPept:AAH67698 (1) 215aa
Select Tool
OTHER MGC:85923 cDNA PAGESNo links to external sites
CITATIONS (3)