cDNA Name: MGC:66343
Sequence Ontology ID : SO:0000756
Previous Name: FR618 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: Sugano SJD adult male
Digest:
Insert Size: 540
Cloning Site: EcoRI-PstI
Vector Type: Plasmid
Vector: pME18S-FL3
Polymerase: T3 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 5 figures (9 images) from Thisse et al., 2004 [MGC:66343]
MARKER RELATIONSHIPS
MGC:66343 Is Encoded by: [Gene] sncb (1)
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC055608 (1) 540 nt
Polypeptide GenPept:AAH55608 (1) 127 aa
Select Tool
Genome Resources:
CITATIONS (3)