cDNA

MGC:55792

ID
ZDB-CDNA-040425-1729
Name
MGC:55792
Symbol
MGC:55792
Previous Names
  • FR4530 (1)
Type
cDNA
Location
Chr: 10 Mapping Details/Browsers
Genome Resources
None
Species
Danio rerio
Library
Sugano Kawakami zebrafish DRA
Digest
Insert Size
3516
Cloning Site
EcoRI-PstI
Vector Type
Plasmid
Vector
pME18S-FL3
Polymerase
T3 RNA polymerase
PCR Amplification
Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
6 figures (8 images) from Thisse et al., 2004 [MGC:55792]
High Throughput Expression
GEO (1)
Marker Relationships
Sequences
Citations