Genomic Feature

ihb589

ID
ZDB-ALT-220315-4
Name
ihb589
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    ( order this )
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 5: 20134982 - 20134988 (GRCz11) (1) Details
Nucleotide change
CCCCCAT/-
Variant Notes
7bp deletion´╝îBetween 144bp to 150bp of the wild-type usp30 coding sequence,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp deleted in Exon 2 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AAGAAAATGAATGAATGAATGTATTCTAGATTTATACGTATACTAGCGATACTTTTAACGTGATGTGACTATATATAATCTTCACATTAGCAGCAATTACTGGAATTATTCTATTGTGGGGAAATGCAACATTTGTCACAATTTTTAATGTTACATAAATGCAGAAATTACAATACGGTGATATTAACCACATTCATAGTAGTTTAACTGAAGACGTCTGCTGATACTAATTTGTTAATTAGTTTGGCCAAGGAGTGATGAGGACATGCTCCGTCACATCCTGTTGATGATTATTCTATTCTCAGAGCGAACCTTAAAACTGTCTCTCACCTACTAAATCTGTCGATTCCAGTTTATCAGCAGTAAGAAGGAAAGAGGTAAACATGTGAGTGAAATTGTGTCTCGATCAAGGAAAAAGAGGAACGATAATGGATAATTGGGGTTGATAAAATGAGGTTGGACACCTTACCTTTTCTCTTCTTCCTCCTGTCTGAAATTGG
CCCCCAT/- AGTACATAGACTCCAGCAGCCATGGCAGCAGCTATTCCACCAATCACGCCCCAGTTCTTCATCATCTTGTTCCTGAACAGAGCGATACAAGTGTTTTTAAATGTGGGGCAAACAGCACAGACAGCAGGGACACCTGTGGAGGACAGCAGACTGACTCTGACCTTGACAGCTGTGTTTGCATTAAGCCTGGCTCTCTGGCAAAACCCTGTAAGCCATCATTACACACACAACACACTTATTTGGGGGAAAAGTAAAGCATGGAAGAGCTGATTCATGCTGCACACTGAATCAAGTAGTACCAATAAGAGTTAACTTCACATCTGTTGTCAAGACAGATTTAATTAGCTTCAATCAGATTATGAAGAGAACTATCCTAACATATTTATAACAGCACCTATTTTGTTAAATGTCTTTAGAATGAATTAAAATCGTAAATAGACACATTTGCTTGTTATTTTATCTGCGACGATGAATGCGATGCATACATAATAGTAAATGCG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations