ZFIN ID: ZDB-ALT-191104-2
Genomic Feature: cu18
Synonyms:
Affected Genomic Regions: nphs1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-nphs1
Lab Of Origin: Harris Lab
Location: Chr 15: 36702204 - 36702205 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 2 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
AACTTTAATTGTACTGTACAGTTTTCCACTCAAACGGTTTCTCATACTCTGTGGGGACGGTTGCTCGCTTACACATGTCTAACAATCGATCGATTGTTTGATTGAATCATTTATATAAACCAACCAAATAACCAACCAACCAACGACTAAATAATGAAGTGTATAACATTTATTACATTACTAACTAGTCACAAACATGAACAAACAAACAAACAAACAAACGAAACACTTCAGCACATTCATTTAACTTTAATTGTACTGTACCGTTTTCCACTCAAACGGTTTCTCATACTCTGTGGGGACGGTTGCTCTCTCACGCACGTCTAACAACATGTCAGCAAACATCTCAACAACTCAAAGATGTTTGTTTTTAATCACCGCATGTCATTCCTCCCTTCCCTCTGAGCTCTCACCTTTCTTCTGGTCTCCTGTCATGCTGTATCGCGGGTATCCAGGCAGAGATCGCAGGGGTCCCAGGAGCAGCCCATCTTTAACCCACT
GC/-
ACGGCCCCTGAGGCCCTCAGCACTTCACACTTCAGCAGAGCCGTGGCCCCTGCTCTGACCGTCACATTACGCGGCTCCGTCTTAAACGCCTGCTGCCCACACACACCTACAGAGACACAAAGACAACAACAGAAAATCTCAGATGCGAGTCAAGGTTAGGATGGAAAAAGTCATTCATTTCCGACTCTGCACGCTGCAAATGTAAACAGTAAATGGCTAAACATAGAGATGCTGCTAACTTTACATTAGCCTTTTTTATTAGACTGACAGCAGATCAGGGATTTTCTATACATGTCATGTTGCTGTGTTTTAGTTACATTGAGAATACTTCATTCCAGAGAACTGGTGCTTGTTCTCATACAGTAATATTGAAAATCAAAGGTGAAATGGGTCTTCAGAAACATTTTATTAAGCTGGTTGAAAGTCTCTTCACATCCCAAAAGCAATCAATAAAGTAAATTAAATGTATGAATTGGAGGTAGCTGAGACATTTATTTCAG
OTHER cu18 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)