ZFIN ID: ZDB-ALT-190822-7
Genomic Feature: bns275
Synonyms:
Affected Genomic Regions: apbb1ip (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-apbb1ip
Lab Of Origin: Stainier Lab
Location: Chr 24: 6063096 - 6063100 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 5 bp deleted (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
ACCATGCTGTCTATCATGTTGTGCAGTCTCTGTATTGGGGATACACATGAAATGCTTTTATAGCTAAACTTTCCACTTGAAGTTTTGGAATAGAGCTGATCTCTATTAAAAAGCAGTCTGGATATGTCCTGTTATACATTCCGTCATGAACTTGGCTAGACATGAAATACCATTCAATAAATATCCGGCCGAGCTAACACTGCAATCATGAGGATAATTACATTTTTATGCTTGGGCTTTTATTTCATTTATTTTTTGTCATGCAGAGTAGAAATGGATTCTGTAGGCATACATAAAGTTCATACTTTATAGTGTCACAGGACTTAAATTGCAGCCTTCAGCTAAAGAGGTGTTAACCGCATGAGGCCAGTGGGTGTGCGGACCTTTCAGAATGAGACTTACTTTTGAAGGTTTAAATGCGGGTGGTGGAGGTGGAGCTGCGATGGAGTTGGAGGAAGTTGCTGGTTTAGAGCTGTCGAATGATGCTGGGAGGCTAAAGT
TACTC/-
TGAGGCTTTGAGGGCGCTGGGGCAACTGAAACTGACCCCTTTGATGTGTCTCTTTCTGTGGCAAACTTTTCCTCCGTGGCACTTATATCTGCCACAAGGTCAGCCATCAAGGCGTCTAAGTCATTGTCTTCCAGATCGTTCAGGGATTCTTGTAGAAAAACAATAGGGGGAAAAGTGAAAGTTGAGAGCTTGTAGTGATAATAACACATGACATGCAGAGGAATCAAACAATATGATGATATAACAATTGGGTATACAAAGAACTCTGTGTGGAAGATCCACACAAATCAAAACAAACTAACTTAATTGTTTGGTAACATTTACAGTAAGCTTGTATTAGTTAGTTACACAGGTAATGCATGTATTAACATGAACAAACACTGACCAATGCATTTATAGCAGTATTTATTCATTTGTGTTGATGTTATTTAATGGAAAGAAAGTTGTTTGTTGTCAGTTCATGTTAACGCAGTGTATTAACTAATGTTAACAAGCATGAA
Comment Citation
The 5-bp deletion, is predicted to cause a truncated protein lacking its  ... Gunawan et al., 2019
OTHER bns275 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous apbb1ipbns275/bns275 apbb1ip Unknown
Complex apbb1ipbns275/bns275 ; vclbbns247/bns247 apbb1ip, vclb
vclbbns247/+ ; apbb1ipbns275/+ apbb1ip, vclb

CITATIONS  (1)