Genomic Feature

sa42634

ID
ZDB-ALT-190501-859
Name
sa42634
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
adult males treated with ENU
Lab of Origin
Stemple Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
Comment Citation
This allele was mapped to ENSDARG00000101186 by the ZMP Project Busch-Nentwich et al., 2013
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 15: 47582422 (GRCz11) (1) Details
Nucleotide change
G/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GTCTATCAAATCTGAGCTTTATTTTGTATTTTATTGGATTTAAGTCAGGTGATTGGCTGGGCCATTCCACAGCTTGATTTTGTTTCTCTGAAAGCATTTGAGAGTTTAGTAGGCTGTGTTTTGGATCATTGTCTTGCTGAAATGTCCACTCTGGTTTCATCTTTATCATCCTGATAATGTAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACACACACACACACACACACACACACACACACTCTCTCTCTCTCTCTCAAACACACACACACACACACACACACTCATATTCTCTCTCGCACATTTTATCCTTCTGCAGCGATTGACCCCGCCCCCAAGATTGACGGACAGCAGGCCTCCATGGTAACCGTGCAGGAGAACGTCACTCACCACTTCAGCTGCCAATCAGAAGGCTGGACCCGT
G/T AAGCCCCACCCCTTCTCACCTGGTACCTGAACGGGGAGCGTCAGAGCGAGGTGACAGGCAGGCGGGGGGCGGGGCCGGGGGCTGGGCGTGATACGTCACCGCGGGAGCTGCGGTTCGGTTCTGAGCGGAACAGTTCGTTCACACTGAGGCCGCGGCGCGGGGACCGGGAGCTGGTGTGTGCGGCGCAGAACACTGCAGACGGAGAAACCTTCAACGCCACCGTCACGCTCAACGTACAGTGTGAGCAGCGCTTATACATCCGCTAGCACTAGCGTACTGTATAGTGTAGACCATGGAGCTGTTCTAAACCTGCCGGAACTACTTTAGCTGTGCTTTTATTTGACAATAACCAAACCCCTGAGATCAGCCAATCAGAGTGCAGGATTCAGCAGATGGGTTTCTGTGATCTGTTAATTGATATGATGGTTCGTCAGGCTGGTGATCTAAATGAGTGACTCTGCCAGTTTTCTCTTTGACCACAGGTGGCGCTAGTGTGCTCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations