ZFIN ID: ZDB-ALT-190501-45
Genomic Feature: sa31894
Synonyms:
Affected Genomic Regions: jakmip3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 41636680 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
FLANKING SEQUENCE (GENOMIC)
CAAAAAGTTAAGGTAACTCAAACCACTTAAGTTCAAAAACTAATCTCTATGAGTACTGTGAACTTATAATATGAAGTAATGAGATATTTAATGAACTCATTACTCTCAACACAGAGTTCAAAACTCTTTTCAAATGAGTAGAATTTTTAGAGTTTCAGACATGCTGATTTAATTGAGTTAACGACACTCATTTCATTTGATAAAGTTGACTATTGGGTTTTACAGTGCAAAAATGGGGGAAAACCATACTGAATTAAACTGAACTTCGATCCTGTAAACTTGACTGACACAGTTTCAATTTACTAGAACTTCTACGTTAAGCTGGTTTGACATTGGTTCTACATTGTAAAAGTGCTATAGAAATAAAGATGAAATTAATTGAATACATAAATATGATACATAGCTAGATATGAATAAAGTGTTTTGTGTAATAGTGTACCGCTTGAGCATGTTGCAGCAGCTCCATTCTCTCTCTCAGGATCTGCGCGTCTCTCTCTCGT
T/A
ATTCACTCAAGACCTGCCGCTTCCACTGATCCACAGCTCCTCTCAGCGAATCCCGGTCCTGTTCACTCAGAAGCTCCGATACCTTCCCGCTCGACTCCTCTCGCTGCAGAGCGTCAAACAGCATCGCCTCCAGCTCCAGGATACGCTGAGAGAGAGAGAGAGAGAGACACACCAGATCAAGAACAGCTACACACACCACTGGGACACTCAAACACAACTGCAAAGCAAAATGCAATGTTATCTGGCCCTGAAGAGACAATATACTCTGGCAGACTACCTTAACACAGTGACAGATAAAGGTCTGAGGAACACCCTGAGCAGATACAGACTCAGCGGACACCAGCTGGCTATAGAGACGGGCCGGCACAGACAAACATGGCTGCCGGTGGAGGAGCGGCTGTGCCCACACTGCCCTCAGCAGCCGATTGAAACAGAACTGCACTTCCTTACGGAGTGCACAAAATACTCAGAGATCCGGGAGAAGTTCTACCCGAAACTCA
(1)
OTHER sa31894 PAGES
ZMP:sa31894 (1)
GENOTYPES No data available

CITATIONS  (1)