ZFIN ID: ZDB-ALT-190426-5
Genomic Feature: ihb343
Synonyms:
Affected Genomic Regions: slc12a3 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-slc12a3
Lab Of Origin: Zhan Yin Lab
Location: Chr 18: 17583946 - 17583953 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 8 bp deleted in Exon 1 (1)
FLANKING SEQUENCE (GENOMIC)
CCCTCGCTTTTACTTGATCCAGCAGACCAATGACGGGATGAACCTCCAAAGCGCAAGAAGCCCATTTTCAGTCTCCTCGCTGAGCAATGGAGACGACCGTAAGTTCAGTTTGGGTGGATGTAGCAGTTATGACACTGACAGCGTGGCCTCACGCAGCTCTGGTGTCTTTTCTGGATATGACACGCTGGATGCACCACCGAGTTACGACTTCTACACCAACACTGAGGTTTTCGGGAGAGCCAAGAAATCCAGACCATCTCTCTTTGAGCTGCACTCCAACCCTCAGGTACAGTAGGAATGACTTACCTGTACAATATTATCATTCCAATATTGTAAGGAAAGTCAGTGATGATTCCACAAAGGAAGGGACTTTTATTATTATTGTTTTTATTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCAGGATGACCCCTCTCCACCTCCCCTGTATGAGGAGTCCAGTGTGGACAAACAGAGTCCAGAGGATGAAGATG
AGCCCACT/-
GAACCACCTCCAGAACCCGCTCGCTTTGGATGGGCTCAAGGAGTTATGGTATGAGGACAAACTCAAAAAAAAGAAGATTTTTGCTGCTTGTTCAAACTACTTATTTAAAAAAGCTGAAACAACACAATTCTTTAAGTTTTTTGGGACAACTCATTTGTTTTATGTACAATCCATTTAAATTTGCAAAAATGATTAAGTTAACTTATTCGATTTGTGTTCAATATGAAGGAATTGTGAGGAACGCAGTTTTTTATACAGTGTTTAACATGATGCTTGTAGGGTCCCACTTGGTTATACAGAAATGCAATTCCAATACATTATGAATATGTATTTGCAAAGAAATGGTGCTGTTTGAGTCCCAGTTGGCATTTCTGTGTGGAGTTACATGTTCGTCTGGGTTTCCTCAGTGTGGTATAAGTAAATTAAATATACTAAATTGACCGAAGTGTTTGAGAGTGTGTGTATATGGGTGTTATGCTGGATAAGTTGGCGGTTCATTC
OTHER ihb343 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)