ZFIN ID: ZDB-ALT-190123-686
Genomic Feature: ouc2010
Synonyms:
Affected Genomic Regions: rsph4a (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR1-rsph4a
Lab Of Origin: Chengtian Zhao Lab
Location: Chr 5: 61923237 - 61923289 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 1 bp inserted / 53 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
AATAACATTTTTCTTAGCCTCCTTCATTTATGTTGAGATATTTCATTTTAAAGACAAGGATAAGGACTTATTCTTTGTCATAAAAATGATGTTACTGAACATACACACAGGAGACGTGCTCATTTTAGAGGAAAATTTTAGATGGCATTTAAAGGTTTTTGCATCTAAACTCTTCATATATATATTGTAACTTAACAAATAGTTTATGAACATACTTGATTGGAATATTGCTTGCATTATTCTTTATCTAATGCAGTCCCTTATGAAAATAAATGATGGTTTTATTATAGTAAAATGTATTAAAAATGTGTTTTGTGTGTTTGTAAATGCTGTTTTGTATCATTTCCAGGTAGATTCTCCTTTACCCAATGTTGCAGAACTTGCGTTTTTCTTTGAGCAAGCTGGCGTGGGTCTGGGGAGAGAGGAGATTCAGAGAATCTTTCTGGCTTTGAAACATCTGGTAGACACACAGCTGCTCTTGCGGTGTCGATTCTGGGGCA
AGATCCTTGGGACACAGGGAAACTACCTGGTGGCGGAAGGGGAATTCAGAGAA/G
GGGGAAGGAGAGGAAGACGAGGGGACAGAACAAACTCCAGAGGAGGACGAGAGAGAGGAAGAGCTGCAGGAGGGCAAGGATGAAGCAGAGCTTGTGGAGGCTGTAAGTCATAAATTAGCATCCTATGTAAATGAATCTGCTGTTAATATTTTAGGTATGGTCACATTAAAGGGTTAGAGCACTCAAATATTAAAGTTCTGTTATTAATTACTCATCCACATATCATTCCATTCCCCTAAAAACCTTCATTGTCATCCAGGGCTGGACTGGGGCAAAAAATCGGCCCTGGCATTTTGGGCCAGAGCGGCCCACTAAATTCAATCAAAATGCTATCTATCTATGCACGTCCAATATTTTTATCAACTCATATTCTATAAAACACAAAAGCCATATATATGAAATAAATAAATAAGTACAAACTTTAATCTCAATTTAATTTCTGTATACTGTCCATAAAGATATTTGTTGAGTTCTAAAAAAATACACTATTCATTCATTTA
OTHER ouc2010 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous rsph4aouc2010/ouc2010 rsph4a ♀+/- ♂+/-

CITATIONS  (1)