ZFIN ID: ZDB-ALT-190116-4
Genomic Feature: ihb332
Synonyms:
Affected Genomic Regions: elovl2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-elovl2
Lab Of Origin: Yonghua Sun Lab
Location: Chr 24: 8870778 - 8870797 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 20 bp deleted in Exon 4 (1)
FLANKING SEQUENCE (GENOMIC)
AATCACTCTAAAGCCATGCATCCTACAAACCACTTGAATGTGCACAGGCAGCTGCAGACCGGTGACCAAATGTGACAAGATGTGAGAGATTATCTCATTCTCCAGTGAGAAAATATTATAGTTCAGGGTGCATATTATTACATTAGCAGCATAATAAGTGCGTGTGTCTACCAACGTGTTTCATCCCAAAGCCAAGCACATTGTTTATTGTGGTTTTAAAAAGAGAGCCATGCTTTTAGAATATTGTTTAGATAAAATTTTGTTGGAAAACATGAGTGCAATCCAGATGTAAAGAGTAGTTCAACCAGCATACCAAAAAATGTTTTTGATACAAATAATCTAGCTTGCATTTAATAGATATATGAGAGCGTCATACTTGTATCAGTACCTACAGCATCAGTATTTTCACGAGCAACAAAAATGGTCTGAGCAGCATAACGAAATAATGGGATGTGCTGTATTTCTTACCCTGATATCTGCTTCACCAACTTCGTCCAGTG
CCTGACACTGAAGACGGTAA/-
CCTGCAGACCAGACTGCTGATATCAGCTACCAAACACATGAAGCACAGCATTAGGTAATCGCTTAAAGAGAACTCGACATTGGCAGATGAGCACATGGACTGCTATTGTAAGATCCAAACAAACTGTATGCTCACTTACCTCAACCAGCATGTAGAAAGACAATACAGTAACAGAGAAGTTGTACAGCAGTAAAACATTTTTCAGTGAGTATGCTGGTCTGTTTCTCATGTATTTTGTTCCCAGGTAGATTGTTAGGAGGTAGGTGATGGTGAGCAAAAATGTTGGTGTGTAGGAATCCAGCAGCAGCCATCCTCTCACGCGGGTATCTGACATCAAACAAACATGTCACTTACTCAATATGTCTGGGTAAGATCATTTTCAGGCAATCTTCTTAAATACAATACTTTCAAACTTTTTGGGAAAACTAAGTGGCCAAGGGAAAACAATCTATGCACCGAATGCATGATTATATTTTGTCATACTAACATAATTCACACGT
NOTES
Comment Citation
The length of the deleted sequence is 20bp. The sequence of  ... Zebrafish Nomenclature Committee
OTHER ihb332 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)