Genomic Feature

ihb332

ID
ZDB-ALT-190116-4
Name
ihb332
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
Other Pages
Note
The length of the deleted sequence is 20bp. The sequence of "TTACCGTCTTCAGTGTCAGG" which existed in exon4 of elovl2 gene from 27bp to 46bp was deleted
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 24: 8870778 - 8870797 (GRCz11) (1) Details
Nucleotide change
CCTGACACTGAAGACGGTAA/-
Variant Notes
The length of the deleted sequence is 20bp. The sequence of  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
20 bp deleted in Exon 4 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AATCACTCTAAAGCCATGCATCCTACAAACCACTTGAATGTGCACAGGCAGCTGCAGACCGGTGACCAAATGTGACAAGATGTGAGAGATTATCTCATTCTCCAGTGAGAAAATATTATAGTTCAGGGTGCATATTATTACATTAGCAGCATAATAAGTGCGTGTGTCTACCAACGTGTTTCATCCCAAAGCCAAGCACATTGTTTATTGTGGTTTTAAAAAGAGAGCCATGCTTTTAGAATATTGTTTAGATAAAATTTTGTTGGAAAACATGAGTGCAATCCAGATGTAAAGAGTAGTTCAACCAGCATACCAAAAAATGTTTTTGATACAAATAATCTAGCTTGCATTTAATAGATATATGAGAGCGTCATACTTGTATCAGTACCTACAGCATCAGTATTTTCACGAGCAACAAAAATGGTCTGAGCAGCATAACGAAATAATGGGATGTGCTGTATTTCTTACCCTGATATCTGCTTCACCAACTTCGTCCAGTG
CCTGACACTGAAGACGGTAA/- CCTGCAGACCAGACTGCTGATATCAGCTACCAAACACATGAAGCACAGCATTAGGTAATCGCTTAAAGAGAACTCGACATTGGCAGATGAGCACATGGACTGCTATTGTAAGATCCAAACAAACTGTATGCTCACTTACCTCAACCAGCATGTAGAAAGACAATACAGTAACAGAGAAGTTGTACAGCAGTAAAACATTTTTCAGTGAGTATGCTGGTCTGTTTCTCATGTATTTTGTTCCCAGGTAGATTGTTAGGAGGTAGGTGATGGTGAGCAAAAATGTTGGTGTGTAGGAATCCAGCAGCAGCCATCCTCTCACGCGGGTATCTGACATCAAACAAACATGTCACTTACTCAATATGTCTGGGTAAGATCATTTTCAGGCAATCTTCTTAAATACAATACTTTCAAACTTTTTGGGAAAACTAAGTGGCCAAGGGAAAACAATCTATGCACCGAATGCATGATTATATTTTGTCATACTAACATAATTCACACGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations