header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181218-16
Genomic Feature: ihb323
Synonyms:
Affected Genomic Regions: stk33 (1)
Type: Insertion (1)
Protocol: embryos treated with CRISPR1-stk33
Lab Of Origin: Yonghua Sun Lab
Location: Chr 7: 28387773 - 28387774 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 2 bp inserted (1)
FLANKING SEQUENCE (GENOMIC)
GTGCAGGGTTTTTGCAAGCGTCACCTTTTTTGTGCAAATAAACAATAGCTTCTGATAAGCTTTTGATGATGTGTCTGGTCTCTTCCTCGGTAAAGTGCTTGTTCTTCTGCAAGAGATCCTTTAGATCGCCTCCTTCACAAAGCTCAGTCACGAGGTACATCCTCTGGAGAGCAGCACACAAACATACACTTCTCATTTCTGACATCAAACCAGAAACCTTGCATACACAAATTATGACACAATAGGCGCTTGGAAGTTTTTGCTTTTACCTTTGGTGTCTCAAAGACTTCCTCCAGATGTATGATGTGTTCGTGTTTCACTTGTTTCATGATGCTGACTTCTCTTTCCAGATGTTTGACACCAGAAGTGCCTGCCTGTGTGGAAACAAAGCGTGACACTTAACCCGTCCTTGAAGACCATGCGAGAGGCTCTCCATCCATCACCTCTGTCAACAGGTGAAACATGACAAGCAAACACTTACCTTCTCTTTGTTCACCTTCT
-/TC
TAATTGCCCACTTCCTCTGCGTCTCGATGTGAGTGGCTTCGCAGACAACGCCAAAGCTGCCTTGACCTAATTTCCTCCCGAAGGAATAGATTTTCTGGATATCCAAATAAAGAGGCCTGCATTAGGTGAAGTATTACATACGCGCTTCTTCTCCTTTAGTGACAGTAAACAACGCTCCAGCTCTGACTAATGGGGACAGAATGAGGGTGGGTTTGTTTTTCAGCTTCTCTATACTCCATTAAGTTGAGACCTGAATCCTTAAAGTGGAACTTAATTTTCAAGTTTGCCAGTCTCTGGAGTTTGGGAGAATATAGTATTTCTAATCAAGTTACAAATGATTAAGTTGCTGCCGCAGTTCATTCAATCTCAGGTCTAATTAACTTGATCATTATCTCTGCGCATGCAAGGCTGAGCACTGCCTGCTGCGGATTTGGCAAAGACAGCAGTCAGAAACCTCTTGAGAGGGCGAGGGCAATCAACAGCATAAAGAGGTGTAATTTC
NOTES
Comment Citation
>WT CATCGAGACGCAGAGGAAGTGGGCAATTAAGAAGGTGAACAAAGAGAAGGTAAGTGTTTGC > ihb323  ... Zebrafish Nomenclature Committee
OTHER ihb323 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)