Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb323

ID
ZDB-ALT-181218-16
Name
ihb323
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
Other Pages
Note
>WT CATCGAGACGCAGAGGAAGTGGGCAATTAAGAAGGTGAACAAAGAGAAGGTAAGTGTTTGC > ihb323 CATCGAGACGCAGAGGAAGTGGGCAATTAGAAGAAGGTGAACAAAGAGAAGGTAAGTGTTTGC
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 7: 28387773 - 28387774 (GRCz11) (1) Details
Nucleotide change
-/TC
Variant Notes
>WT CATCGAGACGCAGAGGAAGTGGGCAATTAAGAAGGTGAACAAAGAGAAGGTAAGTGTTTGC > ihb323  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp inserted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GTGCAGGGTTTTTGCAAGCGTCACCTTTTTTGTGCAAATAAACAATAGCTTCTGATAAGCTTTTGATGATGTGTCTGGTCTCTTCCTCGGTAAAGTGCTTGTTCTTCTGCAAGAGATCCTTTAGATCGCCTCCTTCACAAAGCTCAGTCACGAGGTACATCCTCTGGAGAGCAGCACACAAACATACACTTCTCATTTCTGACATCAAACCAGAAACCTTGCATACACAAATTATGACACAATAGGCGCTTGGAAGTTTTTGCTTTTACCTTTGGTGTCTCAAAGACTTCCTCCAGATGTATGATGTGTTCGTGTTTCACTTGTTTCATGATGCTGACTTCTCTTTCCAGATGTTTGACACCAGAAGTGCCTGCCTGTGTGGAAACAAAGCGTGACACTTAACCCGTCCTTGAAGACCATGCGAGAGGCTCTCCATCCATCACCTCTGTCAACAGGTGAAACATGACAAGCAAACACTTACCTTCTCTTTGTTCACCTTCT
-/TC TAATTGCCCACTTCCTCTGCGTCTCGATGTGAGTGGCTTCGCAGACAACGCCAAAGCTGCCTTGACCTAATTTCCTCCCGAAGGAATAGATTTTCTGGATATCCAAATAAAGAGGCCTGCATTAGGTGAAGTATTACATACGCGCTTCTTCTCCTTTAGTGACAGTAAACAACGCTCCAGCTCTGACTAATGGGGACAGAATGAGGGTGGGTTTGTTTTTCAGCTTCTCTATACTCCATTAAGTTGAGACCTGAATCCTTAAAGTGGAACTTAATTTTCAAGTTTGCCAGTCTCTGGAGTTTGGGAGAATATAGTATTTCTAATCAAGTTACAAATGATTAAGTTGCTGCCGCAGTTCATTCAATCTCAGGTCTAATTAACTTGATCATTATCTCTGCGCATGCAAGGCTGAGCACTGCCTGCTGCGGATTTGGCAAAGACAGCAGTCAGAAACCTCTTGAGAGGGCGAGGGCAATCAACAGCATAAAGAGGTGTAATTTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations