header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181217-10
Genomic Feature: hzu6
Synonyms:
Affected Genomic Regions: ush2a (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-ush2a
Lab Of Origin: Mugen Liu Lab
Location: Chr 17: 29771488 - 29771504 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 17 bp deleted from position 136 to 162 (1)
FLANKING SEQUENCE (GENOMIC)
AGCAGGTATTGAAACTGATCCCGTTGATTAAGTAAAATATTCACTCTCTAAGTGACAGAAACACTTGCACTACCTCTCTGATCTTCTTAAGGGAAAATTCTGGACGTGTGTCTACTTACATTACAGTGTCTTGCTCGAGTTTCAGCCACACCGTTAAAGTAAATGAGCTCGCTGGGCTGTAGCCTAGAGTCGAGGGGGAAGCCGGACAACCTTTTGAAGTGGGAAAGACGAAGCTGCTGGAATTGGCCTCTGCGCCTGGCCGAAGGTCCCGTGCATCGCCCTTCCAGCACGTGGCCACGTTTACGGTGAGAACATCAATGTATTCGGGTGTAGAAGGCCTGCGAGGACACTCTTGGATGCAGAACTTCTGGATGCAAGTGAGGAGATCTTCCTGAACCTGGCCAGCTTGACAGAAAGTACTCCTTTCGGGAATCCCGCACGTGGCTCTCGCTGGTGTGGTGCTGACAGATTTATGTGCCCCTATGTTCTCGAGCCTGGGG
AAGTTGCCCTGAGGGGC/-
AACCAGGCTGAGGGAGGCATAAAAGCCCAAGGTGTACAGTAATAACATAGCACCTTTGTGCCCAAGGAGCCAATTCGTTGTTGGTGGCGAGGTTGCCTCCTGATGTAGTGATCTTAAATAAGTAATGATGGTCATGCCGGTGGTGACATTTTTACAGTCCAGTGCCTTGGGTAAGGCAGCGCAGCTTAATGGCACAATGTCAAAGAGGAGGCCAAAGCCTTCACATGATAGCTAGGATTTGGGCTCCGTCAAAGTCCTGTAGAAAACCAAAGGAGAAAAGGAAGAGCAAAATCATTTGTGAAAACCTATTTAGGAAAAATATTATACCCTGACATCTTCCCTGAGGCTCTAAGAATTCCAGTTGATGCAAGAAAAGCTTAACAATTACTTTTGCCGGTGCATCTGATTTGAACTGAGCGTGGCTTTGTGTCAATCTACCCTGAATTCAAATGGCATTGCAAAGAGGAGAATTATAATACCCATTCTAAAACGGTGTATAG
NOTES
Comment Citation
Between 136 bp to 162 bp of the wild-type ush2a coding sequence,  ... Zebrafish Nomenclature Committee
OTHER hzu6 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ush2ahzu6/hzu6 ush2a ♀+/- ♂+/-

CITATIONS  (2)