Genomic Feature

hzu6

ID
ZDB-ALT-181217-10
Name
hzu6
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Mugen Liu Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
Between 136 bp to 162 bp of the wild-type ush2a coding sequence, GCCCCTCAGGGCAACTT, is deleted.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 17: 29771488 - 29771504 (GRCz11) (1) Details
Nucleotide change
AAGTTGCCCTGAGGGGC/-
Variant Notes
Between 136 bp to 162 bp of the wild-type ush2a coding sequence,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
17 bp deleted from position 136 to 162 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AGCAGGTATTGAAACTGATCCCGTTGATTAAGTAAAATATTCACTCTCTAAGTGACAGAAACACTTGCACTACCTCTCTGATCTTCTTAAGGGAAAATTCTGGACGTGTGTCTACTTACATTACAGTGTCTTGCTCGAGTTTCAGCCACACCGTTAAAGTAAATGAGCTCGCTGGGCTGTAGCCTAGAGTCGAGGGGGAAGCCGGACAACCTTTTGAAGTGGGAAAGACGAAGCTGCTGGAATTGGCCTCTGCGCCTGGCCGAAGGTCCCGTGCATCGCCCTTCCAGCACGTGGCCACGTTTACGGTGAGAACATCAATGTATTCGGGTGTAGAAGGCCTGCGAGGACACTCTTGGATGCAGAACTTCTGGATGCAAGTGAGGAGATCTTCCTGAACCTGGCCAGCTTGACAGAAAGTACTCCTTTCGGGAATCCCGCACGTGGCTCTCGCTGGTGTGGTGCTGACAGATTTATGTGCCCCTATGTTCTCGAGCCTGGGG
AAGTTGCCCTGAGGGGC/- AACCAGGCTGAGGGAGGCATAAAAGCCCAAGGTGTACAGTAATAACATAGCACCTTTGTGCCCAAGGAGCCAATTCGTTGTTGGTGGCGAGGTTGCCTCCTGATGTAGTGATCTTAAATAAGTAATGATGGTCATGCCGGTGGTGACATTTTTACAGTCCAGTGCCTTGGGTAAGGCAGCGCAGCTTAATGGCACAATGTCAAAGAGGAGGCCAAAGCCTTCACATGATAGCTAGGATTTGGGCTCCGTCAAAGTCCTGTAGAAAACCAAAGGAGAAAAGGAAGAGCAAAATCATTTGTGAAAACCTATTTAGGAAAAATATTATACCCTGACATCTTCCCTGAGGCTCTAAGAATTCCAGTTGATGCAAGAAAAGCTTAACAATTACTTTTGCCGGTGCATCTGATTTGAACTGAGCGTGGCTTTGTGTCAATCTACCCTGAATTCAAATGGCATTGCAAAGAGGAGAATTATAATACCCATTCTAAAACGGTGTATAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations