header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181119-18
Genomic Feature: sa45653
Synonyms:
Affected Genomic Regions: krt91 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 5380548 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILSNo data available
FLANKING SEQUENCE
CCAGCAGAGTAGGAGCGAGAAGCAGAAGCACTGGAGATGCGTGTGCCATA
A/T
CCTCCAGCTCCTCCGTGCACACTGCCTGCATACATGCCAGAGACACGTCC
(1)
OTHER sa45653 PAGES
ZMP:sa45653 (1)
GENOTYPESNo data available

CITATIONS  (1)