header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181112-5
Genomic Feature: ihb292
Synonyms:
Affected Genomic Regions: slc39a6 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-slc39a6
Lab Of Origin: Yonghua Sun Lab
Location: Chr 2: 42171081 - 42171107 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 27 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TGGGCTGACTGGGGCTAAAGGAGGCGTGGTCCTGTGTAAAATCATAATCGGCGCTGCGATTGGTCCGCCGTGATCTGGTAACATATGACGGCGTAGTCAAAGCTGTGGTGGATTCCTGGTTCATCTTCATGTACAGGTTGTGATGCGCATCTGACTGGCTTTTCTTCCCAGAGGCAGGATCTGGCTGTGCTTTTGGGACAGGGTCACTCTTCTCCACGCTGTGATCCATGTCTCCCTTCTTGGTGGTGACCGGATGTGTGTGCGCCGTGAGTTTGTCCACATGAGTGTGTGTGTGATCATGCGTGTGTGTGTGATTATGGGCATTTCCAGGATGATGCACCATCACTTTCCGGATGCGGTCAAGCCCGACCCCTTTAAGTAGGTTGAAGAGGCCTTCTAGGGAGATGCTGCCGTTCTGGCCATACTTGTCGAACAGAGCCTGTAGGTGACGCTGCTGTGTTTGTTCTGCTATGCGGCTGTCAGTCTCAATGGCCACAGAT
TTGCAGTCTGAACCCGCCCCCACTGAA/-
CACGCCCACAGCAGTGCCAGTGACATCACTGGGCAGAGGCGTGGCCACCAGCCAATCATATTGGCAACCTAAAACAGACAAACATACAGTATAGAGTTCATGGTATAACTTTAAAACAAAGAGTGTTTTCACAAGAACATTCTAGAAACTAAGCATTTGTCATTTTCAAAAGTGTTACGTATACATGACAATACTGTCAATATGATACCTCCATGAAGTTGGCATTTAAACAAATAATCCCCAAAATTATGCCATTTGTTTATGCTACGTTAGTACTGATATGTGCCGCAAAAACGAACGCTAGTGCTGGTTTGGGATCTGAGATATTATGCATTATTTTTCAGACCGTGTGACGTCACTTTCCACCCCATGTTGCTCAAATGACTTCAAATCAGCACAGGTCGTTTGCGTTCGATTTGTGCCATCAAAACAAGCACGGTATCTGTTTTCCTCGTTTAGTTATAAGTAAAATATTTTGGGAGCCGTGACGTCACTCTCCA
NOTES
Comment Citation
Between 168 bp to 194 bp of the wild-type slc39a6 coding sequence,  ... Zebrafish Nomenclature Committee
OTHER ihb292 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)