Genomic Feature

ihb292

ID
ZDB-ALT-181112-5
Name
ihb292
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
Between 168 bp to 194 bp of the wild-type slc39a6 coding sequence, TTCAGTGGGGGCGGGTTCAGACTGCAA, is deleted. The mutated slc39a6 codes for a truncated protein containing 55 aa, 55 aa of which is identical to wildtype slc39a6.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 2: 42171081 - 42171107 (GRCz11) (1) Details
Nucleotide change
TTGCAGTCTGAACCCGCCCCCACTGAA/-
Variant Notes
Between 168 bp to 194 bp of the wild-type slc39a6 coding sequence,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
27 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TGGGCTGACTGGGGCTAAAGGAGGCGTGGTCCTGTGTAAAATCATAATCGGCGCTGCGATTGGTCCGCCGTGATCTGGTAACATATGACGGCGTAGTCAAAGCTGTGGTGGATTCCTGGTTCATCTTCATGTACAGGTTGTGATGCGCATCTGACTGGCTTTTCTTCCCAGAGGCAGGATCTGGCTGTGCTTTTGGGACAGGGTCACTCTTCTCCACGCTGTGATCCATGTCTCCCTTCTTGGTGGTGACCGGATGTGTGTGCGCCGTGAGTTTGTCCACATGAGTGTGTGTGTGATCATGCGTGTGTGTGTGATTATGGGCATTTCCAGGATGATGCACCATCACTTTCCGGATGCGGTCAAGCCCGACCCCTTTAAGTAGGTTGAAGAGGCCTTCTAGGGAGATGCTGCCGTTCTGGCCATACTTGTCGAACAGAGCCTGTAGGTGACGCTGCTGTGTTTGTTCTGCTATGCGGCTGTCAGTCTCAATGGCCACAGAT
TTGCAGTCTGAACCCGCCCCCACTGAA/- CACGCCCACAGCAGTGCCAGTGACATCACTGGGCAGAGGCGTGGCCACCAGCCAATCATATTGGCAACCTAAAACAGACAAACATACAGTATAGAGTTCATGGTATAACTTTAAAACAAAGAGTGTTTTCACAAGAACATTCTAGAAACTAAGCATTTGTCATTTTCAAAAGTGTTACGTATACATGACAATACTGTCAATATGATACCTCCATGAAGTTGGCATTTAAACAAATAATCCCCAAAATTATGCCATTTGTTTATGCTACGTTAGTACTGATATGTGCCGCAAAAACGAACGCTAGTGCTGGTTTGGGATCTGAGATATTATGCATTATTTTTCAGACCGTGTGACGTCACTTTCCACCCCATGTTGCTCAAATGACTTCAAATCAGCACAGGTCGTTTGCGTTCGATTTGTGCCATCAAAACAAGCACGGTATCTGTTTTCCTCGTTTAGTTATAAGTAAAATATTTTGGGAGCCGTGACGTCACTCTCCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations