Genomic Feature

zju14

ID
ZDB-ALT-181112-1
Name
zju14
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Fudi Wang Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 17: 48132964 - 48132970 (GRCz11) (1) Details
Nucleotide change
GCACTGC/-
Variant Notes
143 bp to 149 bp of the wild-type slc39a9 coding sequence, GCACTGC, is deleted.  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TATATATATAATAGTTTTACTCTTTTTATATAAAAAATATATAAGAGATAAATATGATATGACGAGCAACAGTAGAGGGTGACAAAGATAAAATAAATATATTTGTAATGTTTAATGCTGTTCTTCTGCTTATTGTCCCATATTGCAGTAACTGAAGAGGAAACTTTTTGGACAAAAAATAGGGAAAATTGTTGATTAGCATTTTGTATTAATAGATGCAGTATTGGTCCACCGAAAAAAGATGGTTTGCCATCTCCAGATTAGAGGAAAGTCCTTACTAAAGGTGGAGGAGTTTAAGTATCTTGGGGTTTTGTTCACGAGTGAGGGAAGGATTGAACGTGAGATTGGCAGGGGGATTGGTGCAGCAGCAGTAATGCGGTCGATGCACCGGTCTGTTGTGGTAAAGGAGCTGAGCCGAAAGGCAAATTTTTGGTTTTGTGTTTTATGTGCTCAGGAGAAGCTGAAGTTGGTGACAGTGTTGGGAGCAGGGCTGTTGTGTG
GCACTGC/- GCTGGCTGTCATAATACCAGAGGGAGTCCATGCTCTCTATGAGGAAATGCTGGAAGGTGAGCTTCAGGTTGCTTTTCAGTCAATGCATTGATTCTATTTCTTTTTTTTTAAACATTTTAGTGTGTATATTAAAATTATGTTAGATAATGTTTTTTTTAAGGGAAATGTTTAAAAAGGTGTCCCCTGAAGGAATTTTTAAATATTTCTCATTGATCAAACTGATCGACTTATATGACTGATGTATATTATATATTGAATATTTAGTACAAGTGTTGCCATGAATATACTGTAGCCAATGCTGTTGAGATGGCATTAAAACAAACAAATAAATAAATAAAATAATAATTAAAAAAAACTTTCTTTTCTTATGTGTGCTTCAAAATAAAAGAATTCTGGTCACAGTTTGACAGATGAGTTGACATAAACCAGCGCTGCTGCTGATCGCCTCTGTGCTGCCTGAAGCCACGTCATAAACTTAACAAACAGGCTATTGATGATTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations