Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb289

ID
ZDB-ALT-181106-11
Name
ihb289
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 15: 23759139 - 23759145 (GRCz11) (1) Details
Nucleotide change
GCAGCTG/CCACCTCCA
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TTGTCACTGTAAATTACACAGTACATAATGTCTCAATATATTTTTCCGGCACTAACTCATAAATCTTCACTTCCACTTGTCAGAAATTAATGCAAATTAGTGCATGTTTAATTAAATACTGCTAAAACTCCAGTTGTAAACAAAACATTTTTTTTAATTAGATTTTTTTAGGTAAATGCAGCTTTATTCGCCAGCAATGTTTTGCACTAACACTTGGAGTCAAAGCCAGGGATTCTGTCTTCTGAATCTCATTTAAATAAATGATGCTAATTATGCACAGCATGCACATATTAATTCAGTGTGTTCAGCATGTTACCTGAATTGTCCCTGAGTAGACTGTCCTGCTGCTGGACGCTGTCCAAGCTGAAGGCATCATGTGAGGGGATGTGGGGCAGTGGTGCAGAGAGAGTGCTGGTTTGAGTGGCAATGGTTCGGCGTCGATGGCAGGGCTGGATGATGCTGCCATTTGGCCAGGCGTCCTGACGCAGCACCTCCATCCT
GCAGCTG/CCACCTCCA TTCGGCGTGCCAGAGTTATGTTCGTCCACTCTGCTTTCCATCTCTGGTCGGGCCATTCCACATACAGTCTTGAAAGGAGAAAAACAAACAAAATGTTACACAAAATCATCAGACCTGTTTGCATGCCAACTGTTTCGTCTAAAACTGCAGTTGGACTCAAAAGACAACATATGCTGTTGCAAAGAAGAGACCTGTTAAAAAGTTATACTCGTTAAAAAATACATTTTTATTCAGATGTAAGTGAAAAGAAACTTAATAATAACATAATAAAAAGATAATCATTATAATAAGATAATGATAATACAATTTATGTAAATGAACATAATAAAAATTGCATTATAACTACAGTATTTATTTATCTTTGTAAATGTTACTTAAAGAAAATAAGGTTGTTAGTTCTTGTTAACTCACAGTGCTTTAACTAATGCTCTCAAGTACTTTGGATTTTAATAATGCATTAGTAAATGTTGAACTGTGAATATTACATTCTAATCATTCTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations