ZFIN ID: ZDB-ALT-181002-397
Genomic Feature: sa45480
Synonyms:
Affected Genomic Regions: dld (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 5758651 (Zv9) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TTTGTTCAGGGGTTTTTGAGCTAAAGTTGCAGGAGTTTCTGAACAAGAAA
G/T
GAGTGACAGGCAACGCAAACTGCTGCAAGGGATCCGCGGCAGAGGGTCTT
(1)
OTHER sa45480 PAGES
ZMP:sa45480 (1)
GENOTYPESNo data available

CITATIONS  (1)