header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181002-191
Genomic Feature: sa45262
Synonyms:
Affected Genomic Regions: si:ch211-157b11.8 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 40779773 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AGTATCACACATTCTAAACCTAATAGCCTCAAACCAAGGACTCCTACAGG
T/C
GAGCCACACACACACAGAAAGATAGCCAGGCAGATACACAGAACAAACAC
(1)
OTHER sa45262 PAGES
ZMP:sa45262 (1)
GENOTYPES No data available

CITATIONS  (1)