header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-180516-7
Genomic Feature: sdu23
Synonyms:
Affected Genomic Regions: fzd10 (1)
Type: Indel (1)
Protocol: embryos treated with TALEN1-fzd10
Lab Of Origin: De-Li Shi Lab
Location: Chr 8: 44297786 - 44297793 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 15 bp inserted / 8 bp deleted in Exon 1 (1)
FLANKING SEQUENCE (GENOMIC)
GTGAGCTCGTCTCCTGCTACCTTCCTCATAACCAGGATCATGATGGTCTTGATGGCTGGTATAGCCCATGCCGCCAGATGGAAGTAGCTGCTGTTGGCTTCGATGGCCTCGTGACCCCATTTTTTTCCAGCTGCGAGGAACCATGTGAGAGTAAGAATGACCCACCACAGGGAACTGGCCATCCCGAAGTAGTAAAGAATGAGGAAGACTATGGTGCAGCCAGTGCTTTCCAGGCCTTCCTGGATGATGTACTGAACTCCAGTGTCACGATCACAGGCCACATTTTCCACCCCCACAAAAAGTCTTACAAGAAAGCCCACAGAGTAGACACAGTAGGACATAGAAAGGAAGATGATGGGCCGCTCAGGGTACTTAAAGCGCTGGGGATCAATGAGAAAGGTGAGGACAGTAAAGGCACTAGAGATGAAGCACAGTATGGACCAGATAGCAATCCACACCATGGAGAAGCGTTTGTCGCCCTGGCTCCAGTACACATCTAC
GTTGGAGT/ACTTGGGGGCACAGG
AACACTTGGGGGCACAGGACTCACTCTTTTGCACATAATGAAACTTTCCAGGGTTGCTGCATGTGGTCTTACCGACCCTCTCTTTAATAGGCAGTTCTTGGCTGTTACCTGGCCGAGGGGGTCGGGAGTCTGGCGACTGAGTGTGGGAGCCCTTTGGGGGCTCATCTGTGCCATTGTTGGGAGCTTCCATACAGAGGTAATTGGGGTCGTTTTTATTTGGCAGTCTGGAACAGTCCAGCGACTCAGGCCAGTGAAAGTTGAACTGCTCCATGATGGGAGAACACTTCTGCCTTGCCTGCTCGCACATCACTCGGCATGCTGGGATAGGTGTGGATACCTGTTCTGTGCACATGGGTGCGTAGAGTGAGCACAAGAAAAACTTCAGATGGCTGTGACAGCCGAACTCAATCAGCGGAGCAAACTCATGCAGCTTTATGGCTGCCTCATTTTGATCTTCATGTCCCATTAAGTTCGGCATAACTGTTAAGTTGTAGCCAATG
NOTES
Comment Citation
Between 635 bp to 642 bp of the wild-type fzd10 coding sequence, ACTCCAAC is  ... Zebrafish Nomenclature Committee
OTHER sdu23 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)