ZFIN ID: ZDB-ALT-170119-27
Genomic Feature: st99
Synonyms:
Affected Genomic Regions: lamtor4 (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN
Lab Of Origin: Talbot Lab
Location: Chr 4: 20051738 - 20051748 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 11 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
CGGTGATTATGACAGCGAATCTGATCCTGATACAGATTATTTTTTGTTAAATGCGAGAACAGCGCATAAATCCTAGCAAATTAAATAAAAATCCGCCACGTTTTAGTCATACTAAGATTTTTTATCACATTTTGTACGTTTCCAATGCATATAAACAAAAATAATGTCGAATAAGCAAAACATCTCCTGGAATGACGTTATAAACACGCGACGCTTGATGTCAGTCACGTGAGGCGGGGTGTGAAGGAAAACAGCAGTGTACATTTATCTGCACTGTCTAAAATGGTAAATATAATTCTTACCTTTAAAATATTTGTTTAATTAAATGTTTTTTTTATTAAATGTTTTGTTTTAGTGCATTTAGAACTTATAAAACAAAGATTTTGTAAATAATGTGATTGATGATGCAGTCTAATATCATATGAGCTCTGTTAGTGTTTAATTACAGTATTATCGTGTGTTGAATGTCAGACTACTGCTTTGACTCAAGGCTTGGAGAG
AATACCCGATC/-
AACTTGGGTACTTGGTTATTAGTGAAGACGGAGTACTCGCGGTAAGCTGTTAAAATTCATAACTTACATTTTCGGAGAACTTGACATGAGGGTGAAATGCGTTGAAAAGAGAATCCTGATTTGGGCAAATGAGAAATAATTAATTAGAATTCAATGTCTGTCAGTCTTATTGTTCTGTCTGTCTCTGTTTGCCTGTCTACACTTTGAGGCAAAATTATTACGCCTCTACTGATACATATTATTTAAAAAAAAATTCCCAAGTTATGATGAACTGAGCAATGACATTTTCACAGTATTTTCTATAATATTTTTATTCTTGAGAAAATTTTTTATTTCTTTTATTTTGTCTGGAATAAAAGCAGTTTTTAAATAAAAAAATAACAATTTTAATAGGTTAATAGGCCCTTAGAACAAAATAATGGTATTCAATGACTTGCCTAGTTAAACTTATTAACCAAGTTAAGCCTTTAAGTTACTCATTAAGATGAATTCTAATATCT
OTHER st99 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous lamtor4st99/st99 lamtor4 ♀+/- ♂+/-

CITATIONS  (2)