ZFIN ID: ZDB-ALT-161003-20680
Genomic Feature: sa5711
Synonyms:
Affected Genomic Regions: si:ch73-40a17.3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 2: 285445 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
TCTAGAGGAGAGCAAACACAGAATGTCAGTGAGTGTGTCGGCAGACGGTCTTCATCCAGTCTCATTAGAACAAACCATTTATTCACGGTGGATCAGTGATCAGCACTGTCGCCTCACAGTAAGAAGGTCTCTAGTTTGAGTCCCGGCTGGGTCAGTTGGTGTTTCTGTGTGGAGTTTGCATGTTCTCCCCGTGTTGGTGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTCCAAACAGATGCGCTATAGGGGAACTGATCAACTACACTGGCCGTAGTGTATGAGTGTGTGTGAATGAGTGTGTATGGGTGTTTCCCAGTACTGGGTTGCAGCGGGAAGGGCATCTGCTGTGTAAAACATATGCTGGAACAGTTGGTGGTTCATTCCGCTGTGGCGACCCCTGATGAATTCGAGACTAAGCTGAAGGGAAATGACTGAATGGTGGTTGTCGGCGCTCACCCTCCATGGTGAGCAGGAATATGGCGTCTCCACCCT
T/A
GATGAAGTCCCGGCTCAGGGCTCTGGCCTGGGTCAGGTACACGGGGGTCCCGGCGCCTGGGCCTCGGAAATACTCCGTCCCATTGTCATCAGTCACTTTCACACCAACTTTACGTGGATCATCCCAGAACAGATTCAGAGATCCTGGAAATAAATGGACTGTATTTTGTTATGTTTACATATTCACGTTCGTCAATCACCCCTCCACCCCCCCCAAACAGACATCCAACATGACCATAATATGACCACGAGTGCCTCTAGGAGAGGGACAGTAAGGACGATTCTAAAGGGCCAATGCAGTTTTGGGGTCCCCCCCCCCAACGTCTTTATTTTCATCATCATCCCCCCCAAAACCCCCAAACACTCGAACAGAAATCCAACAAGATAGTATGACCAGAGTGCTGCTAGAAGAAGGAAAGTTAGGACGAATCTAAGGGCCCAAAGTTTCGGGGCCCCCAGAGTTTGTCTAGATTGAATATTGTCCCCCTTCTTCTTCACTTT
(1)
OTHER sa5711 PAGES
ZMP:sa5711 (1)
GENOTYPES No data available

CITATIONS  (1)