ZFIN ID: ZDB-ALT-161003-20080
Genomic Feature: sa959
Synonyms:
Affected Genomic Regions: fam120c (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 23: 18406786 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TAAAATACACACAAAAAAATCACCAAACTTTTATAGTTTAAAAAAACATT
A/T
CCTGAGCTTTTAATGGCTGTACTGCCCCCACATGGCCTGGAGGTCCAGCA
(1)
OTHER sa959 PAGES
ZMP:sa959 (1)
GENOTYPESNo data available

CITATIONS  (1)