ZFIN ID: ZDB-ALT-161003-20076
Genomic Feature: sa953
Synonyms:
Affected Genomic Regions: aldh3a1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 15: 20801354 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
TGATCAAAATTTGCCAACTGATGGTACACATTTACATATATGATTATTGTAAACTGTCTCTTTTGAAAAGTGTAACTTTGATATTTATATAAAACAAAGTGTTCTAAGGTTTTTGTACTGTTCTTCAATCATTCATGAAACATGGACTGAGTAGTGACCTTGGAATTTAGGAAATTGTATGTTGTTTTCCAATTTTTAACTGCTGTATAATAAAAATGACTGCATTTACATTAATAGAGAAAACCAATAAGACTTTATATATGGAAGCTGATAACTAATATATATATTTATACTTCCCTTTGTGACATCCTAAACCCTCTTCATTGCAGTGTGGATTATTGTCTATTGCCATCGCAATTTCACTTTATTATAACTTTTTTATCCTGCTCACTCCTGAAGGAAATTCCTAATTCAGACCTGTACAAATGGAGAAGCAGGTTGTAGATGGATTAAGGGAGGTCTTCCAGTCAGGCAGATCCAGACCCCTGCAGTACAGAAAA
C/T
AGCAGCTTAGAGCTCTGCTCCGGCTCATCACTGAACGCCATGCAGACATTGAACAAGCTCTAAAGCAAGACCTTAACAGGGTACGGAAGAGATATTGACTTATCCAATTTTCACTAAAATGACACAAATGCAAGTTTTTAATCCTTGTTTTGAATTTGCAAACAGAGTATGCATGGCACTTCACTCTTTGAGTTGATCGGCATTGAGAATGACATCAAGGTGGCAGAGCGTGAGATGACAGAGTGGGCAGCTCCTCGGCCTGTGAAGAAGAATCTCAACTCCGCACTTGATGATGTTTACGTAAAGCCTGAACCTTTAGGTGTTGTGTTGATTATTGGAACCTGGAACTATCCTTGGGCCATGATCTTTCAGCCCCTTGTTGGAGCTATTGCAGCTGGTAATGGAATTCTTTTTAAAATGCACATAAGAGAAGAATTCAATCTATATGAAAAGCTTTTTCAAACAAATAGGGTTGTAAATTGCACTTAATTTAGGCATGT
(1)
OTHER sa953 PAGES
ZMP:sa953 (1)
GENOTYPES No data available

CITATIONS  (1)