header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-19139
Genomic Feature: sa769
Synonyms:
Affected Genomic Regions: gpatch8 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 37666521 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AGTAGTCGCAGCTCCAGTCGAAGTAGTTGGAGTAGCAGTGCTCGTTCTTA
C/A
AGACGCAGTAGCTACAGTCGCAGCCGTAGCTCTGCTAGTCGTTCATCTAG
(1)
OTHER sa769 PAGES
ZMP:sa769 (1)
GENOTYPES No data available

CITATIONS  (1)