header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-19125
Genomic Feature: sa7625
Synonyms:
Affected Genomic Regions: fn1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 9: 15417497 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Missense (1)
FLANKING SEQUENCE
AGACGTGCAGGAGTAAAACGTTTTCCCCATGAACACAAAAGGGAAAGCAC
A/T
CGGTTCGCCACCTGAGGTCCCGCCATACACCTGAGATTGACTCTCTACAC
(1)
OTHER sa7625 PAGES
ZMP:sa7625 (1)
GENOTYPESNo data available

CITATIONS  (1)