ZFIN ID: ZDB-ALT-161003-19122
Genomic Feature: sa7622
Synonyms:
Affected Genomic Regions: si:dkey-32e23.4 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 51008489 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Missense (1)
FLANKING SEQUENCE (GENOMIC)
TTATTATTTCATAAACAAATATATGAAATTAGTCCTGGAGCAATGAAGATAAGTAATCAGTCAAAAGCCACACATCTCCTGAAAATATGTTTTAAATTTGGTGGCGAAATTACGCTAAATGACATTTCTGAAAAACATTTTCTGAGACAATATCTTGTGCTCGTCTCTGTCTCCTTGTTAAGTGTCACTTTAAGCTGAATGCTAGTATCTTGATAAATATCTAGTCAAATATTGTGTGCTGTCATCATGGCAAAGATAAAAGAAATCAGTTAACAATTTCATTTATCAAATTCATAACTAATAATTCAGGAGGACTAATAATTCTGACTTCACCTGTATGTTTTTTCCCATCCAGGAGTCAACATGACTTGAACACTCAGAAGAGTCTCTCTGACTCCTGTAGGGATGAGCAGGCGTTTCTGCAGCGGCATTACCCGTCATTAGCTTCTCGCTGCGGCTCCCGCTATCTGGCTCGCACCCTGAGCCGCCTGCTCATGCAT
C/A
ACATCAGAGACTGCCTGCCGGAGCTCAAGACCCGTGTCACGGTGCTCACGGCCCAGTATCAGTCCAGACTCAACAGCTACGGGCAGCCGGTGGAGGACCACAGCGCCACCTTGCTGCAGATCGTCACCAAGTTCGCCACCGACTACTGCAGCACAATCGAAGGCACGGCCAGACACATCCAGACCTCTGAACTGTGAGTAGCAGAACTCTTTATTAATGTTCGTATCCAAGCTCTCATTTCAACATAGGCTGAGTATGGTTGCATTTCGTCTTTAAGATGAACGCTACGGGCGGGATGACGGAATTACTTTACGTGCTACCAGCTGACTGCTTACCTTCGTATGGACGGCTTTACCGCTGTTGTTAGTTTGTCCAGTTAGCTCACCATGTCGGTGCACTTTAGATGCAAAGAGGAGTTGACCATGACGACGGGGTTCGAGTCTAGTAAAGAACGGTTCCAGAAAGTGCGTTAGCCAAAAATGAAACAAACAGGTAAAAAA
(1)
OTHER sa7622 PAGES
ZMP:sa7622 (1)
GENOTYPES No data available

CITATIONS  (1)