ZFIN ID: ZDB-ALT-161003-18778
Genomic Feature: sa7158
Synonyms:
Affected Genomic Regions: aak1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 49002107 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
ATTTATTTATTCCTTCATTCATTTTTTATTTTCTTTATTCATTCATACATTTATTTGTTCATTTATTTATTTATTCATTTATTTTTTATTTTCTTTAATTATTCTTTTTTTCTTTCTTTCTTTATTTATTCATTTATTTTTTATTTTCTTTATTCGATCATTTATTTTTTGTCCATTTATTTTTTTATTTTCATTATTCATTAGTTTATTAATTTATTTATATATTTATTCATTCATTTATTTATTTATTTATTTATTTATTGTCATTATTCATTAATTAATTAATTTATTTATAAATTTATTTATTCATTTATTTATTTTAATAAAATCACAGAGGGCTAATAGTTTTTTGTCTTCATGCTACTGTATACTAAGAGTGCCATTGTTAACGAAAAGGTATTGTATGTGTTTAGTTGTTCTTTTTTTAGACAGTGCTCAGAAACAGTGTCTCTTGTATGTTTGTGTCCTCAGGCTTTAGGCTGCTTGTTGTATAAGTTGTG
T/A
TATTTCACATTGCCGTTTGGAGAGAGTCAGGTGGCTATCTGTGACGGCAGCTTCACCATCCCAGACAACTCCAGATACTCACACGATATGCACTGTCTCATCCGTAAGAACAGCTCTTCCTTTCTCTTCTGATTTATATGTTAAGGGAAGACTGTCTCACAGAGTTTGGTACTTGGTTTCATGGTTTAAATGTTGTGTGTCAATTAAGGCTTAATCCCTATTCCACCACTTAGCCCTTCCCCTTACTCCTACCCCTTGCTTTGCACTTTCATGTAAAAGGGAAGCATATGTTTTAATACATTCATAATGACAACAAATAATAACTTGACTTCTAATTGATCATTTGGAAAAGTGGCAGAAGGTAGATTTTTCCCATGAATCATCTGTTGAACTGCATCCCAATCATCACAAATACTGCAGAAGACCTATTGGAACCTGCATGGACCCAAGATTCTCACAGAAATCAATCAAGTTTGGTAAAGGAAAAATCATGGTTTGGG
(1)
OTHER sa7158 PAGES
ZMP:sa7158 (1)
GENOTYPES No data available

CITATIONS  (1)