ZFIN ID: ZDB-ALT-161003-18771
Genomic Feature: sa7151
Synonyms:
Affected Genomic Regions: hps4 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 39781617 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
CTTCAATTCTGAGTCACATGACCACCAAACTGCATTAAAAGAGCAAAGTCTGACAGAAAGTCTTAACAGAAAACAGGACACCGACACAAACTCTGAGTCCGAATCCAAAAGCGAAGGTTTGAATTCAGACCAGGACGTCCAGAGTGAAGAAATCAAAGCCCTCACTAATGGCTTTCAAGAGTTGAACTCTCATGAAAACCATGCTTCAGACAATGATGAGCAGTTTCAAAGTACCGCAGATAAACTGGAATCTGACAGTCATGTGACCAGTAAAAATGGCAAACTGCGAGGGGAAATGGAGGCAAGAACATTGAGCAAGCAGGCTGACAGAAGACATCAGGATAAATACAAGCCCACAAGTACGCTCTCACCAAATGAAACCAAGGAAGACCCCTCGCTAGTCCCCTCGATATTATACCAGCATAGGGTCCGAGGCCTGGTTCTGGCTCTCCTGGTAGAGCCTGAATTCAACACGGACCCAGCAGCCAGAGAAGAAGTGG
T/A
GAGAAGTAAATCGGTTATACTTGACGTGGATGGGTTTGGAGTCAGTAAGAGAAATTTATTTAGTTTAATTTTTTTAATTTAAATAAAAGAACTTAATAATCTGGTATTAGTCCACACGTAAGCTAATGATACATTCATTACTGTTAAAATCTACATAAATATTGATTTACAGTAATTGGACAGTATATATTTTAGCCTAGAATTGAATGTTTTTATTAATGAACAACATTTGTTAGACTTTTGGGCGGTTTAACAGAGTTAGTGAATCTTGAACTTGTATTTTGTGCTAGACCTGGCAGCTTTGAGCTGGACATTCTGTTGGCATGGATCTTGACATTCTATTTGCATGGGTAATAGTTTTTTAATAGGAATAATTGACGATGGACTATCAAAGTTTTAGGAAAAGCCACATCAACACATAGGGTGTGTATTATTGTATAATAACTCAATAGACTGGAGTGAATAATTCCACTTATACTACCTGAAGACACTGTTGAGAT
(1)
OTHER sa7151 PAGES
ZMP:sa7151 (1)
GENOTYPES No data available

CITATIONS  (1)