ZFIN ID: ZDB-ALT-161003-18770
Genomic Feature: sa7150
Synonyms:
Affected Genomic Regions: hps4 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 39781534 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
CTCTCTGATGAACCATACTTCAGTCCATCTCCTTCACGGGGGAACACTCCCCTTCACTCCAACCTCCTCAACCAATCAGAGTACTTCAATTCTGAGTCACATGACCACCAAACTGCATTAAAAGAGCAAAGTCTGACAGAAAGTCTTAACAGAAAACAGGACACCGACACAAACTCTGAGTCCGAATCCAAAAGCGAAGGTTTGAATTCAGACCAGGACGTCCAGAGTGAAGAAATCAAAGCCCTCACTAATGGCTTTCAAGAGTTGAACTCTCATGAAAACCATGCTTCAGACAATGATGAGCAGTTTCAAAGTACCGCAGATAAACTGGAATCTGACAGTCATGTGACCAGTAAAAATGGCAAACTGCGAGGGGAAATGGAGGCAAGAACATTGAGCAAGCAGGCTGACAGAAGACATCAGGATAAATACAAGCCCACAAGTACGCTCTCACCAAATGAAACCAAGGAAGACCCCTCGCTAGTCCCCTCGATATTATA
C/A
CAGCATAGGGTCCGAGGCCTGGTTCTGGCTCTCCTGGTAGAGCCTGAATTCAACACGGACCCAGCAGCCAGAGAAGAAGTGGTGAGAAGTAAATCGGTTATACTTGACGTGGATGGGTTTGGAGTCAGTAAGAGAAATTTATTTAGTTTAATTTTTTTAATTTAAATAAAAGAACTTAATAATCTGGTATTAGTCCACACGTAAGCTAATGATACATTCATTACTGTTAAAATCTACATAAATATTGATTTACAGTAATTGGACAGTATATATTTTAGCCTAGAATTGAATGTTTTTATTAATGAACAACATTTGTTAGACTTTTGGGCGGTTTAACAGAGTTAGTGAATCTTGAACTTGTATTTTGTGCTAGACCTGGCAGCTTTGAGCTGGACATTCTGTTGGCATGGATCTTGACATTCTATTTGCATGGGTAATAGTTTTTTAATAGGAATAATTGACGATGGACTATCAAAGTTTTAGGAAAAGCCACATCAACA
(1)
OTHER sa7150 PAGES
ZMP:sa7150 (1)
GENOTYPES No data available

CITATIONS  (1)