ZFIN ID: ZDB-ALT-161003-18291
Genomic Feature: sa6487
Synonyms:
Affected Genomic Regions: arhgap5 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 17: 31784204 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TGTGGAAACAAGACGGATCAAGACAATATTCAGAAACAATTCGACCAGGG
T/C
ACGTACTGATTTATAACCGGGCTCTGTGGGAAATTAAGCTTAATTTGCAA
(1)
OTHER sa6487 PAGES
ZMP:sa6487 (1)
GENOTYPESNo data available

CITATIONS  (1)