ZFIN ID: ZDB-ALT-161003-18091
Genomic Feature: sa6224
Synonyms:
Affected Genomic Regions: ankrd13c (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 11: 45411234 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ACACACACGCTGGCCTCACCCCAGCTCTGGAAGTCCCAGTGCAGCTCTAG
A/T
TAGAAATCTCCAAGCTGAAGAAGAGAGAAACACAGAACATCACTGAGAGC
(1)
OTHER sa6224 PAGES
ZMP:sa6224 (1)
GENOTYPESNo data available

CITATIONS  (1)