ZFIN ID: ZDB-ALT-161003-17756
Genomic Feature: sa5788
Synonyms:
Affected Genomic Regions: enpep (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 12546728 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AACATCTTGACTCCTTATGATGCTTTCATTTTTTGTGGCTTCAAGCAACC
T/A
GTTAGAAAACAAACATGTTGAAATAGTTTCAATTTATATCAATTCATTAA
(1)
OTHER sa5788 PAGES
ZMP:sa5788 (1)
GENOTYPESNo data available

CITATIONS  (1)