ZFIN ID: ZDB-ALT-161003-17745
Genomic Feature: sa5754
Synonyms:
Affected Genomic Regions: sfi1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 40907722 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATCCTTGACAGGTTTGCATAGCGCACGCTGCTTCCATCGAAGAGCGCATC
G/A
CCTCACCACCTCCTGAAGCTGACGACAGCTCTGTACAGTATGCAGATTTC
(1)
OTHER sa5754 PAGES
ZMP:sa5754 (1)
GENOTYPESNo data available

CITATIONS  (1)