header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-17031
Genomic Feature: sa41011
Synonyms:
Affected Genomic Regions: per1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 7: 50841782 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TGGAGCTGGAGGACAGGCCTCGTCTAACCAGAGAGGGTCAGCGGTGGATT
C/A
AAAAACAAACGAAAATGTAAGTAGTTAAAAAGAAAATTTGATTTAGGTAG
(1)
OTHER sa41011 PAGES
ZMP:sa41011 (1)
GENOTYPESNo data available

CITATIONS  (1)