header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-16992
Genomic Feature: sa40662
Synonyms:
Affected Genomic Regions: pik3r5 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 19976154 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AAGCTTTACCTCATCACACTCTGTAAAATTTTCTTCTCATCTTGGTCCAG
A/T
CAAACTGCGAAGGTGGTGTTGCAAGTTCCACTAACCTGAACCTTATCCAC
(1)
OTHER sa40662 PAGES
ZMP:sa40662 (1)
GENOTYPES No data available

CITATIONS  (1)