ZFIN ID: ZDB-ALT-161003-13905
Genomic Feature: sa29815
Synonyms:
Affected Genomic Regions: col8a1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 22: 28650196 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
GACCAGGAAGTCCCGGAGGGCCCCGAGGCCCTTGAAGCCCTATCGGACCGGGCTCTCCAGGAGGACCTTTCTGTCCTCTTGGAACTGTTTCACCTGAAAAAAAAAACAAAGAATAGAAAGAATAGAAACAAGAAAGCATTGTTTAAAACAGTCAAATAGGATGTTAAAATGAATGGATAAAAATGACATGGTCAAAAATATAAACAGTATGAAATATTTTTAATACATATATAATTCACCAGATGTATATTATGGAAAAAATATGGAAAAATCTGATTAAATATGACGACAGGTGTTTTTAAGTGGTTCATCCATTAAAATGCTTTCTTTAAATAAACATTGCATTGCATTTACAGTTCATTTAAATTATCCAGGCAACCCTGAGAAAATAATTTACCAATATTCTATTAAAGCTTTAAGTGAATATAAAGTAATGTAAAGTGTTTAGCAAAATTACCAACCTTTTCTTGCAATCGGTATGCCCATATGCATGGGAAACT
G/A
TGGACGTTCCTTCCCATACTGTGGAAGCAAAGGCATCTCATTTCCAAAGGGAAGTTGAGGGATTTCCTTTCCATGGTAATGGTGTTGTGTTATTCCTTCATTGCCATGTGGTAGAAGAGGTAACTGTGGCAGAGGCTGGCGCTTTTGAGGCAATGGTTTGTGTCCATAAAATGCCCCCGCATGGATATGATGTAGCAGGCACAAATGCTCCACCAGTACAAACAAGCAGGCAGAGAGGAGAGGCCCAGCCATGTCCTGTTGAATAGAGCATAGACATTTGTAATTAGTAGGCTTCTAAAATTCAGGAAAGTTAGTAGTCAGGGTCCAGATCAAAGGTTAGCAAAATCCCTTTTTATTTATTTTTTTACTGAAACAGCTCATTGTTATATGTCTGGTTGAAGAGCTGATACCCATAAGTTTATTGGTTTGTCTCCCTACCAGAACTAAGCAATCAACAATCAGTAAAAGACTGAGTTTTAGATAAACATTTTAACTTACTA
(1)
OTHER sa29815 PAGES
ZMP:sa29815 (1)
GENOTYPES No data available

CITATIONS  (1)