ZFIN ID: ZDB-ALT-161003-13113
Genomic Feature: sa27185
Synonyms:
Affected Genomic Regions: ajap1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 21663136 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
TTGCAAATGTTTAGGTGAACCTTAGGTATGAATGCTCTGTTACAGTAGGCCTACATGTGAATTGCTTGGTTTCAGCTCAGCAAGTAAATTTTAGTGTCTTGTAGGGAACAGAATGCTTCAGACGATGAGATGAGAAACTGAAATATAATGTGATGTCATAAAAACATTGTGGCAGAAATGCTAAACTTAAAGATTTCAAATATTAAGATTTTCTAGATAGGAATTTTAAAATTGTTTAGAGCATACTAGTTAACAGATAACCTCATTAGAATTGAAACGAACACCCCCAAAAACCTGATCATTTTAGGCCTTTAAGATGCAGCTTTAGAGTTTTTGCAATCAAATACATACTGTAATACGATCAAAAAGAAAAGGTGACATGCTGTAACCGATAACAGTATTATTATTTTTCTCTTTTAGGTCTGGCTGTTCACCAGATCATCACCATCACTGTGTCCCTCATTATGATCGTCGCAGCCTTGATCACTACTCTAGTCCTT
A/T
AAAACTGGTAGGATACATTCTTTTCTTTCAGTAGAGACTTTCCTGTCTATCTGTCTGTCTATCTGTCACTCCCTATTCCTGTCCTTCTGTCTGTTTATCTTTTTTTCAATCTGTCCTTCTCTTGCAGTTTGTTTGTAAGAGTGAGCTCATATTGCACAAATCGAACACTCGTACACAAAAGAATGTTCCCGAACCCAGTGAGCTTCAGATATCTTCTACTTGTCACATTTTAAGATCTGCAGAAAGAGCAATCACAGAGTGCGCTAAAACATGGCTGGTGAAAATAATATCAGTTAAAACAGTTCCTGAAAAAACATGGTATATAAAAGAATAAATAATAATAAAAAAAATAATAATTGTTTTTTTAAATAGTTAACAAATAAAAGAAGGGGTTGACGTTTTACTGGAAATTGAAATGTTCATTCTTATAATTGGGGAAAATGTATCAATGATAATAATAAAGTTTTTTTTATGTTCTTTAAAGCTTTTCAAAAAACTAA
(1)
OTHER sa27185 PAGES
ZMP:sa27185 (1)
GENOTYPES No data available

CITATIONS  (1)