header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-12978
Genomic Feature: sa26764
Synonyms:
Affected Genomic Regions: raver2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 31455358 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GAGCGCTCCTGCAGAATACACTCAGCAGTACACTCAGCAATACACACAGG
T/C
AACTACAACACACACACATGAGAAACTGCACAAATATAAAATGATGCAAA
(1)
OTHER sa26764 PAGES
ZMP:sa26764 (1)
GENOTYPESNo data available

CITATIONS  (1)