ZFIN ID: ZDB-ALT-161003-12667
Genomic Feature: sa25858
Synonyms:
Affected Genomic Regions: ing5b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 2: 36607498 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
ATTTATATGGATATACCATAATAAATTGAGAGTGGTTGTTGATATTAACGTCCTGATTGTGGCACATTAGTATATGTGAGGGGGCTTGTACATAACATATGAAAGAATAAAGTTACGTTAAAGCCAAGCACACCGGTGTTTTACTTGTGAAATTCACAATACGTTTTATTGAGGTGTATCCATATCAATGGCCCACCCTGTATAGCCCCACCTCCATATATGCACATTAATGTATAAATACAGAGACTTTCAGTCTAAGCCAGCACTATTTAATAGCTTAACGCTCACCAAATAAAAAGAGATTTTATATCTGTTTAATCTACAGCAAGGTATCTAAACCTTTTCCCCGAAGTTAACAACTCATACTCATTATGCAGAACATGTCATAAATCACAAACGATTTGTTTAGCATCTCCTAATGTGTCCTGTTCATAAATCTGCTGCAGTGACATCTGTACTGACACACCAGTAAAGTAAAAACAAATGAATTTATATTTCCA
G/T
GTGGATAAACACATTCGGCGCTTGGATGCTGAGCTAGCACGCTTTGAGAATGATCTGCAGGAGAAACTGGACTCGGGCAGCCAGGATAGCTCTGATGAAAAGCAATCCAGAAGTAAGTCTTCATGAAGATATTGAGACAATTTATCCTTTAAAGAAGAAAAATTAACTGACAAATTTATTGTTTCAGAAGATAAGAATATGAAAGATAAGAGGGGATCTCATGCAAGAGACAAGAAAGCATCAGATCAAGACTCACCCAAGCAGAAAAAAATGAAAAATGGGTAACTGATTTTGATTGGATACATGAATTTGATTGCCAAACCAGCCTTTCACTTGAACTCTTTTCTTTTGACTTTTACAAATTTCAGTCCCAACATAAGTGAATCTCTGCTTGCAATGCACCCATCAGATGTCCTGGATATGCCTGTGGACCCTAATGAACCCACATACTGTTTGTGTAGTCAAGTATCATATGGAGAAATGATTGGATGTGACAATTC
(1)
OTHER sa25858 PAGES
ZMP:sa25858 (1)
GENOTYPES No data available

CITATIONS  (1)