ZFIN ID: ZDB-ALT-160601-7688
Genomic Feature: sa41763
Synonyms:
Affected Genomic Regions: dnajc16l (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 11: 3609375 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
CGCAAAAATGAAAATTTACTCACTATTTACCCTCGAGTGCTTCCAAACTTTTATGAATTTCTTTATTCTGTTGAACACAGAAGATAATATCCTGAAAAAAGCTGAAAACCGGTAACCATTGACGTCTATGGTAGGAAAAACAAATACTTTAGAAGTCAATGGCTACAGGTTTCCAACATTCTTCAAACTACCTTCTTTTGTGTTTAACATAATGATAAGGGTTTAAAACTTGTAAACTTGACGACAGGATTTTTCTTTTTGGGTGAAGTGTCCCTTTAACAAATAAAATGACTTTATTTAATACAAGTTTATTATGCAAATCCAATTACAACCATTTTTTTTGTTAAAGCTACAGCAGGTCTCTCATATAATACATACAATAAATGACATTGACAATATTACTTTACAAATTATACTGTACACACATCACCTAAACATTCAAACTGAACAACACACTGAATGACAGGCTCAAAAACAGGTAGATTTCAGCCTTATTACTC
A/C
CCATTCTCTTGCCAGTTTCTTGTACATTTTCTTGATTTCAGTGAGGCTTGCATGTTTAGACACTCCGAGAACACTGTACGGATCAAACTCGGGTGCAGATGCCAATGAATCACCAAACAGAGCAAGAAGAAGAATCGCCCAAGCACAGCAGCTCACAAAAACACTCCAGCCTCCCATCTTCTGATACATGAACTGCGACAGACTTCACAAACAGATGAGATTGGGGAAGTGTCACATTTATTCACTCCAGAAAATAACTGATTCTACTATAAATGCATCCTGAAAGTAGGGTGGTGAAATTTATCGATATTATCAAAATGTGCATATACCAATATATGGTTGGTAATAAATAAGTAATTAAACACAGAAGTATCTTTGAGTGCCTGCCTTAAGGCTGATTTACACTTCTGCGTCAAACGGCGACGTAAGCTACGGTGCTGATGCATAACCCTTCGCTGTGGCCGTCGGTGTCGCTGACGTGCACCTCTCAAAAAATGTAA
(1)
OTHER sa41763 PAGES
ZMP:sa41763 (1)
GENOTYPES No data available

CITATIONS  (1)