ZFIN ID: ZDB-ALT-160601-4858
Genomic Feature: sa36752
Synonyms:
Affected Genomic Regions: recql4 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 2797821 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CCTCTGGTGAAGCGAGGACTCAGACAGCTGCAGTGGGGCTCAGACACAGG
T/C
CAGCCATGGATGAAGCCATGCACGCCACACACAACCCTCCAAACGAACAT
(1)
OTHER sa36752 PAGES
ZMP:sa36752 (1)
GENOTYPESNo data available

CITATIONS  (1)