ZFIN ID: ZDB-ALT-160601-3853
Genomic Feature: sa35400
Synonyms:
Affected Genomic Regions: eloal (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 2326152 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
TCAAGTCTCACAGGATTGCACTCCTCAATGCGCAGGAGCTGTTCAGCCGTGCAGCGCTCCAATACTGGCTCCAAAATCTCAAACGGTACTCCTCCAATTTCATAGAGAGCTGCAAAACATGTACCATTAAGCTGAATTAACTGGCTGGCCAATTAAGCTTCAGTTTAGTTTACACCAGTTCTGGGTTTTAGGTACTTATGCCGTATCAGCAGCATTGGCTATGCTACTATTATACTTGTATTAAGTATATAATTTATTATTTACAATCATCACTGTTTCTTAAAAAAATCATGCATTGTACAAATAAATCAAACATATAAATAACAACAACTGACAAATTCAAGATCTTTCAATGCTCAAAGCTTTTTTTAAAACATTTCTCTTTATAGAGTTAGATTTGTTTCTTTATTATTTAATCAATATATTTAGTTCATCACTGAATGAGGCTTCTTTACTCTTAAATTATTGAGCTGAAGATCATCATGGTGTGTTTTGTACGT
A/T
CAGTCGATGTTGTTCTGCAGCGCTCGGATGCACTGCTGGTACAGAGTCATCATGGAGGGCAGAAATGCCATCTTGCTGCCCGAATACACCTGCATCTTATTCTTTAGCCGCTGTCCAATGAACATCGGCGCCGCCTCCTCATCCTCACACACTTCAGTCGCTCTTCTGTCATCTGAATTAAAAATAAAAAAATGTTTTACCTTCACAGTTTCAAATTCTTAATTTAAATAAATAAATAAAAAATAAATTAAATGTTTAAACTAATAATAAATAAACACTTACAGAACTCTATACAATACTATGATCCCATATTAGATCATTTAACTATTGGGCACTGAAATGGTGTTCAAAGCCTTGCTTCTTAATGCCTTTATTACATATAACAACTGAAAGTTCTGTGTTTTGACAATATTGCAAGTTCACTAAAAGCTGGCTGGAATTATTAGATAACTTTAACATAAATATTTAATAATATAACTCATAGTAATACACTAATTGCT
(1)
OTHER sa35400 PAGES
ZMP:sa35400 (1)
GENOTYPES No data available

CITATIONS  (1)