ZFIN ID: ZDB-ALT-160601-3559
Genomic Feature: sa35008
Synonyms:
Affected Genomic Regions: dnajc16l (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 11: 3607049 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AACCGAGAATGGATGGCGTGCGGTGAGCACCAAGATGGTTAGCCAGCTGTCTCTCATATCCAATGTCCACCACACCGATACCGACTCCTTCAAACCACAAACAGATATTATAAAGTTGTGTTCTCTCAATTCACTGAAAAACAATGACTAACTACTATGTACTACAACCGAACCGCTCTAGAGTTCATTTTAATCGAGCCATAATTCAGGCGGTGTAGACCAATTGTTTTAGCACAGATCAGACAGTGATTGCGGGTTTCACATATGCCCAAACGACAAGCTGAGGGGACAAACACGCCAAACAAATGTATGCACCGTAAATCACTTACCCAAGGGCTCCAGCTCCAGCACAGTGTCCTTCCATATGGGTTCGATGTGAATGCAGGTGAAGCACCACTCGGAGGTGATCTTGATCAGGTAGGGTCTCTTGAAGCTGTCCGGCAGCACCTCATTCATGTACTGGTTGTAGTGTAGGAGATGTTTGCTCTCGGTGAAGTCTC
G/A
ACTCGTCCGAGGGAAGTGAAAGAACGATTCGTCGAAGTAGAAACTGTCATGATACTGTCTGAAGCCCTGCGGCGGCCGCGCAAAGTTTTGATTCTCATCCATTTGACCAAAACGATCATAGTTCGCCCTTCGCTCCTCATTTGATAAAATCTGTGTGAAATAAATCATGAATGCTTATTATTGAAGTTATTTTCAAACGCTTGAATGAGTGCAATTCTGAGTAATGTGGAAAACATGTAAAGTTGTAGAATCTGCTCATCTGAAATGAAAAACAAATAAAAAAAAACTCTCAAATTCCCTGTTTGGTTGCTTTGTCAGTTTATATTAACTCTTGAAAAAAAAACTACCTGCATTTACAGAAAACTCTACTGACTGGGCTAATTAATACTATAAAATATGCTAATACAATTTATGCCAATGACAGAATTTGTCACCCATAAATTATATTTACAGTGCTCAGAATAGTTGAGTACACCCCATTTTGAAAATGAATATTTCTA
(1)
OTHER sa35008 PAGES
ZMP:sa35008 (1)
GENOTYPES No data available

CITATIONS  (1)