header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-151228-2
Genomic Feature: ct828
Synonyms:
Affected Genomic Regions: nmur1b (1)
Type: Small Deletion (1)
Protocol: embryos treated with zinc finger nuclease
Lab Of Origin: Prober Lab
Location: Chr 2: 13382651 - 13382655 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 5 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
AAGGCACACAATAGAGAGACAGCCCATAACACAAGGATAACACGCTTTGCATGAGCACTCGTCGCAACATGTTTGGTGTGCAGAGGATGAATGATAGCTCTATAACGTTCTGCACTTAAGGCTGTAACATTGAGAACAGAGGCAAAGCAGACTGTCTCAAAGAGACAGGTTTTGAAGTAGCAGCCAGAAATTCCAAACAGAAAAGGATAGTTGCTCCAGAGCTCATAAAGCTCCAGCGGGAGGCCAAGCAACAGCACAAGGAGGTCAGAAATGGCCAGGCTGAACAGGTAGTAGTTTGTCGTTGTGCGCATGATGCGATGACGGGTAATGACAATACAAGTTAGGATGTTGCCCACCACACCTACTACAAAGATGAGCAGGTAGGTGACACATATAGGCAGAAAGAAAGGTGAACGACAGGGTCCAAGGTATTTCTCCAGGTAGGCACTGCGGGATAGACAGAGGTCTGATAGGTTTGCTGTTCTGTTTTGACATTCTTC
TTCTT/-
TGGTGGAGCACCATGACGTGTTCACAACAACTGTGAACAGTGAACTTGGAGAGGAGCAGTTGTACTGTATCATTGATTATCAGATGAAAATTACCTATAGGGTTACAAAAAAAGACATACAGGTCAAATGCTTAAACTGTTATGTTCCACAATTTCAACAAAATATCATGTGGCACTTCAAATAATAATGAAATGAAATAACTTGCATTTCAAAAATTTATTTTGATTGATTTTAAAAAATCCTAATATTATTCACTCTTATTTTATTTATTTAGATTTTCAATTATATATTATTTTATAATTATATACTTATATTGATCGTTGATCATGCTAACTAATTAACCAGGTTGACACATGGAACCCTACAAAAATAACTAAACGGGTAAAATTTCACATCGAAAAAAAAAAAAACAATGAATTCAAAAGCAAGGTACTGGAACTTTCTACATATACACTTGCATATTTTTACATTATTTGTCATTTGTAATAATACATATACA
NOTES
Comment Citation
5 bp deletion (AAGAA)
ZFIN binding sites: TGCTCCACC and GAAGAATGT
ZFIN Staff
OTHER ct828 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous nmur1bct828/ct828 nmur1b ♀+/- ♂+/-
Heterozygous nmur1bct828/+ nmur1b Unknown
Unknown nmur1bct828 nmur1b Unknown

CITATIONS  (2)