ZFIN ID: ZDB-ALT-151019-2
Genomic Feature: uob203
Synonyms:
Affected Genomic Regions: fdx1b (1)
Type: Indel (1)
Protocol: embryos treated with TALEN1-fdx1b
Lab Of Origin: Ferenc Müller Lab
Location: Chr 5: 22225916 - 22225927 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 5 bp inserted / 12 bp deleted from position 294 to 305 (1)
Transcript Consequence: Frameshift (1)
FLANKING SEQUENCE (GENOMIC)
TATCATGAAATGCTTCTACCTTAATCTATTTGCCCCTGGTGATAAAGTTGTTCAACTTAAACTTAAAAAGATAATGCTCTTTGCAACATAAATTTGAGTTACTGGATCTGGAGGTCTGTACACCAATTTCTTTCACTCCAGGTTATTTTTGCTCAGTTCTCACACACACACAAGGCTTCAGACTTTATGCTTGTTGGCTTTGTTGAGGCAGGAGAATATCCAGCTCTGCCTGTAAACATTTTTCTTTTGTGATAGATGAATAACATTTTGTCAGTAATTACTTTACTTGTGTATATAAAAAAACAACGCATTCAAAGTTTTATTGAATCAATTAAACGTATTACATTTTACAAACATGTAAGACCTTGTTTATTTAGACTGTTTGGATGATATGGACTTATGAACATATAAAATGAATAAAAGTGTGCTTGTGGATGTGTGTGTGCGCGCATGTGTGTGTCTATATTAGGAGCATGCGAGGGCACTCTGGCCTGTTCCAC
CTGTCACTTGAT/TTGTC
ATTTGAGGAGAATGTGTTTGACAAACTGGAGCCAATGGTGGATGAAGAGATTGACATGCTGGATTTGGCTTACGGAATCACCAAGACGTAAGAATCCTGGATTTAATATATAAAGCTTGTCTGATTAAGTCAGTAATGAGTGCTAAAAATGTCCATAAATATTTCTATAATAATAACAACAATGCATATTATAGTTTAATTAGAGTGTTATGTTGTTTTCATTCATTTAAAATATTTATTATATATTCATTAAGAATGAAATGGACTAGAATTAATATGGCATGATGAAATATTGACTAAAAGTACAGGTAAACAGCAAACTTTCCTTTATTAAAACGTATAGCTCTTTTTTTTTTCTCTGCAAATTGTTGCAATGATTTTTTGGTGCTGTTTTCTCATTGGCTCAGATCTCGATTGGGTTGTCAGGTGACTGTGGAGCGCTGGATGGACGGAATGACTGTTCGCGTGCCACAAGATATCAAAGATCAACGAGGAAAACA
Comment Citation
This allele harbors a 7 bp indel that causes a frameshift predicted to remove  ... ZFIN Staff
OTHER uob203 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous fdx1buob203/uob203 fdx1b ♀+/- ♂+/-

CITATIONS  (2)