ZFIN ID: ZDB-ALT-151019-1
Genomic Feature: uob205
Synonyms:
Affected Genomic Regions: fdx1b (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-fdx1b
Lab Of Origin: Ferenc Müller Lab
Location: Chr 5: 22225917 - 22225928 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 12 bp deleted from position 295 to 306 (1)
Transcript Consequence: Inframe Deletion (1)
Protein Consequence: Amino Acid Deletion: 4 AA missing from position 99 to 102 (1)
FLANKING SEQUENCE (GENOMIC)
ATCATGAAATGCTTCTACCTTAATCTATTTGCCCCTGGTGATAAAGTTGTTCAACTTAAACTTAAAAAGATAATGCTCTTTGCAACATAAATTTGAGTTACTGGATCTGGAGGTCTGTACACCAATTTCTTTCACTCCAGGTTATTTTTGCTCAGTTCTCACACACACACAAGGCTTCAGACTTTATGCTTGTTGGCTTTGTTGAGGCAGGAGAATATCCAGCTCTGCCTGTAAACATTTTTCTTTTGTGATAGATGAATAACATTTTGTCAGTAATTACTTTACTTGTGTATATAAAAAAACAACGCATTCAAAGTTTTATTGAATCAATTAAACGTATTACATTTTACAAACATGTAAGACCTTGTTTATTTAGACTGTTTGGATGATATGGACTTATGAACATATAAAATGAATAAAAGTGTGCTTGTGGATGTGTGTGTGCGCGCATGTGTGTGTCTATATTAGGAGCATGCGAGGGCACTCTGGCCTGTTCCACC
TGTCACTTGATA/-
TTTGAGGAGAATGTGTTTGACAAACTGGAGCCAATGGTGGATGAAGAGATTGACATGCTGGATTTGGCTTACGGAATCACCAAGACGTAAGAATCCTGGATTTAATATATAAAGCTTGTCTGATTAAGTCAGTAATGAGTGCTAAAAATGTCCATAAATATTTCTATAATAATAACAACAATGCATATTATAGTTTAATTAGAGTGTTATGTTGTTTTCATTCATTTAAAATATTTATTATATATTCATTAAGAATGAAATGGACTAGAATTAATATGGCATGATGAAATATTGACTAAAAGTACAGGTAAACAGCAAACTTTCCTTTATTAAAACGTATAGCTCTTTTTTTTTTCTCTGCAAATTGTTGCAATGATTTTTTGGTGCTGTTTTCTCATTGGCTCAGATCTCGATTGGGTTGTCAGGTGACTGTGGAGCGCTGGATGGACGGAATGACTGTTCGCGTGCCACAAGATATCAAAGATCAACGAGGAAAACAA
Comment Citation
This allele has a 12 bp deletion leading to a 4 aa in-frame deletion  ... ZFIN Staff
OTHER uob205 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous fdx1buob205/uob205 fdx1b ♀+/- ♂+/-

CITATIONS  (4)