ZFIN ID: ZDB-ALT-140917-9
Genomic Feature: um196
Synonyms:
Affected Genomic Regions: hoxb1b (1)
Type: Indel (1)
Protocol: embryos treated with zinc finger nuclease
Lab Of Origin: Sagerström Lab
Location: Chr 12: 27141736 - 27141741 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 5 bp inserted / 6 bp deleted in Exon 1 (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
GACCTACATAGCGACTTTATCAGATTGACGGGTGGATTCGATTGATGTGTTTGTCATGTAAATACGAATCGTTTGATGGACACCTGCAACGCCCAGAGTGCTACCGCAGGTCGCACACTATTGGCGCAAAATTAGTCACATGATCTGTCACTTAACTGATATGAGCTCAGATACAACTTTGCGTGGTTTGACATACTGCTTAGAGGTTGTAGGGGCACTGGGACCACACATCAGCTCATATTGACCCTGCTTAATCAATTTTGCTTGGTCAGTCAACAATGAATTCTTACTTAGATTATACGATTTATAACCGTGGTTCTAACACTTATAGTTCGAAAGTTGGGTGTTTTCCTGTAGAGCAAGAATACTTGCCAAGTGCTTGTGCAAGTACAAATAGTTACATTCCCGAGGGACGGCCAGTCGGAGGAAACACTTTCACATCGGCACCGCACGAAACTCATGGCACATCTTACGCACAAATTCAATCGCAGCCCTTCCAC
CTCAAC/ATTCC
GTGGACATGGGTAAAACAGGACACAGCAATTTCTGCAAGCAAACCAGACCTCCTCATTCGGACTATGGACATCAACACGTTCTCACTCAAGCAGATGACCACATGCGCCTTCAGTCCCCTGGCTTTTCCGTCGTGAATATGGGAGCCAATATTGGAACTTACAGTGAATCAAACTGCAGGCCTGGCTCGGTCTCTGCAAGCCACTATCAATCATATGCATATGGAGAACCCGAACCACACGGCTATGGTTCGTTCAGCAAGTATCAGGTCTCCCCTGACAGTGACAGCGACTCCAAGACGAACATTAAACAAGCGCCAACCTTTGACTGGATGAAAGTCAAGAGGAATCCCCCTAAAACAGGTGAGTTATGACTAGTTACAATGGCTATAGATAATGTGATATTAAAATACAGTTTCTAAGTCGTGTTTTTATTCAATGCTAATTTTCAGTTAAAGTCGCCGAATACGGAATCCATGGCCAGCAGAACATAATACGCACC
NOTES
Comment Citation
Weicksel et al, 2014: Insertion/deletion (−1 bp) in exon1 of hoxb1b Weicksel et al., 2014
OTHER um196 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous hoxb1bum196/um196 hoxb1b ♀+/- ♂+/-

CITATIONS  (2)