header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-140917-10
Genomic Feature: um197
Synonyms:
Affected Genomic Regions: hoxb1b (1)
Type: Indel (1)
Protocol: embryos treated with zinc finger nuclease
Lab Of Origin: Sagerström Lab
Location: Chr 12: 27141724 - 27141740 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 36 bp inserted / 17 bp deleted in Exon 1 (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TAATTCACATTAGACCTACATAGCGACTTTATCAGATTGACGGGTGGATTCGATTGATGTGTTTGTCATGTAAATACGAATCGTTTGATGGACACCTGCAACGCCCAGAGTGCTACCGCAGGTCGCACACTATTGGCGCAAAATTAGTCACATGATCTGTCACTTAACTGATATGAGCTCAGATACAACTTTGCGTGGTTTGACATACTGCTTAGAGGTTGTAGGGGCACTGGGACCACACATCAGCTCATATTGACCCTGCTTAATCAATTTTGCTTGGTCAGTCAACAATGAATTCTTACTTAGATTATACGATTTATAACCGTGGTTCTAACACTTATAGTTCGAAAGTTGGGTGTTTTCCTGTAGAGCAAGAATACTTGCCAAGTGCTTGTGCAAGTACAAATAGTTACATTCCCGAGGGACGGCCAGTCGGAGGAAACACTTTCACATCGGCACCGCACGAAACTCATGGCACATCTTACGCACAAATTCAATCG
CAGCCCTTCCACCTCAA/TGTTTCAATCGTGAAACACAAATTCACAAATTCAAT
CGTGGACATGGGTAAAACAGGACACAGCAATTTCTGCAAGCAAACCAGACCTCCTCATTCGGACTATGGACATCAACACGTTCTCACTCAAGCAGATGACCACATGCGCCTTCAGTCCCCTGGCTTTTCCGTCGTGAATATGGGAGCCAATATTGGAACTTACAGTGAATCAAACTGCAGGCCTGGCTCGGTCTCTGCAAGCCACTATCAATCATATGCATATGGAGAACCCGAACCACACGGCTATGGTTCGTTCAGCAAGTATCAGGTCTCCCCTGACAGTGACAGCGACTCCAAGACGAACATTAAACAAGCGCCAACCTTTGACTGGATGAAAGTCAAGAGGAATCCCCCTAAAACAGGTGAGTTATGACTAGTTACAATGGCTATAGATAATGTGATATTAAAATACAGTTTCTAAGTCGTGTTTTTATTCAATGCTAATTTTCAGTTAAAGTCGCCGAATACGGAATCCATGGCCAGCAGAACATAATACGCAC
NOTES
Comment Citation
Weicksel et al, 2014: Insertion/deletion (+19 bp)in exon1 of hoxb1b Weicksel et al., 2014
OTHER um197 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous hoxb1bum197/um197 hoxb1b ♀+/- ♂+/-
Complex hoxb1aum193/+; hoxb1bum197/um197; hoxb1aum194/+ hoxb1a, hoxb1b

CITATIONS  (4)